Illumina Adapter/Indexing Sequences


Nextera Index Sequences

     
50ng input Nextera
i7 index namei7 bases in adapter i5 index namei5 bases in adapter
N701TCGCCTTAN501TAGATCGC
N702CTAGTACGN502CTCTCTAT
N703TTCTGCCTN503TATCCTCT
N704GCTCAGGAN504AGAGTAGA
N705AGGAGTCCN505GTAAGGAG
N706CATGCCTAN506ACTGCATA
N707GTAGAGAGN507AAGGAGTA
N708CCTCTCTGN508CTAAGCCT
N709AGCGTAGC
N710CAGCCTCG
N711TGCCTCTT
N712TCCTCTAC
Nextera XT
i7 index nameKit Versioni7 base for entry on sample sheeti5 index nameKit Versioni5 base for entry on sample sheet
N701ATAAGGCGAS502ACTCTCTAT
N702ACGTACTAGS503ATATCCTCT
N703AAGGCAGAAS505AGTAAGGAG
N704ATCCTGAGCS506AACTGCATA
N705AGGACTCCTS507AAAGGAGTA
N706ATAGGCATGS508ACTAAGCCT
N707ACTCTCTACS510ACGTCTAAT
N710ACGAGGCTGS511ATCTCTCCG
N711AAAGAGGCAS502BCTCTCTAT
N712AGTAGAGGAS503BTATCCTCT
N714AGCTCATGAS505BGTAAGGAG
N715AATCTCAGGS506BACTGCATA
N716BACTCGCTAS507BAAGGAGTA
N718BGGAGCTACS508BCTAAGCCT
N719BGCGTAGTAS510BCGTCTAAT
N720BCGGAGCCTS511BTCTCTCCG
N721BTACGCTGCS513CTCGACTAG
N722BATGCGCAGS515CTTCTAGCT
N723BTAGCGCTCS516CCCTAGAGT
N724BACTGAGCGS517CGCGTAAGA
N726BCCTAAGACS518CCTATTAAG
N727BCGATCAGTS520CAAGGCTAT
N728BTGCAGCTAS521CGAGCCTTA
N729BTCGACGTCS522CTTATGCGA
N701CTAAGGCGAS513DTCGACTAG
N702CCGTACTAGS515DTTCTAGCT
N703CAGGCAGAAS516DCCTAGAGT
N704CTCCTGAGCS517DGCGTAAGA
N705CGGACTCCTS518DCTATTAAG
N706CTAGGCATGS520DAAGGCTAT
N707CCTCTCTACS521DGAGCCTTA
N710CCGAGGCTGS522DTTATGCGA
N711CAAGAGGCA
N712CGTAGAGGA
N714CGCTCATGA
N715CATCTCAGG
N716DACTCGCTA
N718DGGAGCTAC
N719DGCGTAGTA
N720DCGGAGCCT
N721DTACGCTGC
N722DATGCGCAG
N723DTAGCGCTC
N724DACTGAGCG
N726DCCTAAGAC
N727DCGATCAGT
N728DTGCAGCTA
N729DTCGACGTC
Truseq Indexing   
Truseq LT single indexing
i7 index namei7 bases on Sample Sheet
Index 1ATCACG
Index 2CGATGT
Index 3TTAGGC
Index 4TGACCA
Index 5ACAGTG
Index 6GCCAAT
Index 7CAGATC
Index 8ACTTGA
Index 9GATCAG
Index 10TAGCTT
Index 11GGCTAC
Index 12CTTGTA
Index 13AGTCAA
Index 14AGTTCC
Index 15ATGTCA
Index 16CCGTCC
Index 18GTCCGC
Index 19GTGAAA
Index 20GTGGCC
Index 21GTTTCG
Index 22CGTACG
Index 23GAGTGG
Index 25ACTGAT
Index 27ATTCCT
Truseq HT Dual indexing
i7 index namei7 bases on Sample Sheeti5 index namei5 bases bases on Sample Sheet
D701ATTACTCGD501TATAGCCT
D702TCCGGAGAD502ATAGAGGC
D703CGCTCATTD503CCTATCCT
D704GAGATTCCD504GGCTCTGA
D705ATTCAGAAD505AGGCGAAG
D706GAATTCGTD506TAATCTTA
D707CTGAAGCTD507CAGGACGT
D708TAATGCGCD508GTACTGAC
D709CGGCTATG
D710TCCGCGAA
D711TCTCGCGC
D712AGCGATAG
Greenleaf ATAC Primers  
Primer nameINDEXPrimer Sequence to order
ATAC_Ad1_noMX:N/AAATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG
ATAC_Ad2.1_TAAGGCGATAAGGCGACAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.2_CGTACTAGCGTACTAGCAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.3_AGGCAGAAAGGCAGAACAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.4_TCCTGAGCTCCTGAGCCAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.5_GGACTCCTGGACTCCTCAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.6_TAGGCATGTAGGCATGCAAGCAGAAGACGGCATACGAGATCATGCCTAGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.7_CTCTCTACCTCTCTACCAAGCAGAAGACGGCATACGAGATGTAGAGAGGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.8_CAGAGAGGCAGAGAGGCAAGCAGAAGACGGCATACGAGATCCTCTCTGGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.9_GCTACGCTGCTACGCTCAAGCAGAAGACGGCATACGAGATAGCGTAGCGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.10CGAGGCTGCGAGGCTGCAAGCAGAAGACGGCATACGAGATCAGCCTCGGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.11AAGAGGCAAAGAGGCACAAGCAGAAGACGGCATACGAGATTGCCTCTTGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.12GTAGAGGAGTAGAGGACAAGCAGAAGACGGCATACGAGATTCCTCTACGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.13GTCGTGATGTCGTGATCAAGCAGAAGACGGCATACGAGATATCACGACGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.14ACCACTGTACCACTGTCAAGCAGAAGACGGCATACGAGATACAGTGGTGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.15TGGATCTGTGGATCTGCAAGCAGAAGACGGCATACGAGATCAGATCCAGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.16CCGTTTGTCCGTTTGTCAAGCAGAAGACGGCATACGAGATACAAACGGGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.17TGCTGGGTTGCTGGGTCAAGCAGAAGACGGCATACGAGATACCCAGCAGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.18GAGGGGTTGAGGGGTTCAAGCAGAAGACGGCATACGAGATAACCCCTCGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.19AGGTTGGGAGGTTGGGCAAGCAGAAGACGGCATACGAGATCCCAACCTGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.20GTGTGGTGGTGTGGTGCAAGCAGAAGACGGCATACGAGATCACCACACGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.21TGGGTTTCTGGGTTTCCAAGCAGAAGACGGCATACGAGATGAAACCCAGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.22TGGTCACATGGTCACACAAGCAGAAGACGGCATACGAGATTGTGACCAGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.23TTGACCCTTTGACCCTCAAGCAGAAGACGGCATACGAGATAGGGTCAAGTCTCGTGGGCTCGGAGATGT
ATAC_Ad2.24CCACTCCTCCACTCCTCAAGCAGAAGACGGCATACGAGATAGGAGTGGGTCTCGTGGGCTCGGAGATGT